''Mesodinium'' nuclear code
The Mesodinium nuclear code (translation table 29) is a genetic code used by the nuclear genome of the ciliates Mesodinium and Myrionecta.[1]
The code (29)
AAs = FFLLSSSSYYYYCC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (29) | Standard code (1) |
|---|---|---|---|
| TAA | UAA | Tyr (Y) | Ter (*) |
| TAG | UAG | Tyr (Y) | Ter (*) |
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
- This article contains public domain text from the NCBI page compiled by Andrzej (Anjay) Elzanowski and Jim Ostell.[2]
- ↑ Heaphy, Stephen M.; Mariotti, Marco; Gladyshev, Vadim N.; Atkins, John F.; Baranov, Pavel V. (2016-11-01). "Novel Ciliate Genetic Code Variants Including the Reassignment of All Three Stop Codons to Sense Codons in Condylostoma magnum". Molecular Biology and Evolution. 33 (11): 2885–2889. doi:10.1093/molbev/msw166. ISSN 0737-4038. PMC 5062323. PMID 27501944.
- ↑ The Genetic Codes (update: Nov. 18, 2016)
This article is issued from
Wikipedia.
The text is licensed under Creative Commons - Attribution - Sharealike.
Additional terms may apply for the media files.